"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
The game uses a parity win condition (checked after venges resolve).
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
PookyTheMagicalBear looks like Dr. Hideyoshi!
shellyc looks like Dr. Hideyoshi!
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
It is now night zero. The mafia are selecting a player to be Adrenaline Tweaked and a player to be the Creator of Dr. Hideyoshi's clone.
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
The lab assistant, Isis, takes a colorful disc, with "Rampage 4k" etched in sharpie on it, to the computer in the lab that could play it, having found it in the staff's rideshare this morning
"I don't think that's actually a thing. That series limped into this millennium and didn't make it far."
Instead of having a game, the screen displayed tons of data from a genome. Including the misplaced CCAGTCAGTCAGGGAGTGAGGGACCGAGGACCTGACCAGAGAGTTAGAGAGCCCCTGAGACCGAGATTTTGAGGACGAGAGATACATA sequence that gave Dr. Hideyoshi a life-altering cognitive state that brought the doctor to the place that doctor had come today.
"The audacity."
The mafia have selected a town player to become Dr. Hideyoshi's Clone's Creator.
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
"Who's turn is it to buy K cups?" Isis asked, sipping the last bit of her coffee.
"You shouldn't buy any, you addicts, you haven't run out," the angry technician Hectic snapped. "The nasty bitterness soils my tea enough as it is."
"Yes, we have run out. There's no more."
"No, when I finished with with the Keurig, there was a six pack of donut shop medium coffee, and a six pack of pumpkin spice flavoured coffee cups. There's only seven of you."
"Hectic I threw that pumpkin garbage out on sight, that swill is an abomination.. but how'd we just drink seven cups?"
The mafia have selected a town player to become Adrenaline-Tweaked.
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
Day 1 will end in (expired on 2020-11-19 05:00:00)
"Let us say that you are right and there are two worlds. How much, then, is this 'other world' worth to you? What do you have there that you do not have here? Money? Power? Something worth causing the prince so much pain for?'"
"Well, I..."
"What? Nothing? You would make the prince suffer over... nothing?"
"I hope one day I can openly play as wolfy as Pooky and get zero pressure for it grumble grumble."
-MariaR
"I can't even look at the game anymore.
That evil teddy bear has got everyone twirling by his thumb.
It's like witnessing an slow but unavoidable train crash you can't stop."
"I hope one day I can openly play as wolfy as Pooky and get zero pressure for it grumble grumble."
-MariaR
"I can't even look at the game anymore.
That evil teddy bear has got everyone twirling by his thumb.
It's like witnessing an slow but unavoidable train crash you can't stop."
"I hope one day I can openly play as wolfy as Pooky and get zero pressure for it grumble grumble."
-MariaR
"I can't even look at the game anymore.
That evil teddy bear has got everyone twirling by his thumb.
It's like witnessing an slow but unavoidable train crash you can't stop."
In post 15, shellyc wrote:pooky you are confscum and the only reason im not voting you is because the town clone dying actually doesn't put us in such a good position tbh
*deep breath* town creator of dr. hideyoshi clone
"I really dig your cult leadery charismatic vibes" - Hectic
We live in a twilight world. And there are no friends at dusk.
"I hope one day I can openly play as wolfy as Pooky and get zero pressure for it grumble grumble."
-MariaR
"I can't even look at the game anymore.
That evil teddy bear has got everyone twirling by his thumb.
It's like witnessing an slow but unavoidable train crash you can't stop."
"I hope one day I can openly play as wolfy as Pooky and get zero pressure for it grumble grumble."
-MariaR
"I can't even look at the game anymore.
That evil teddy bear has got everyone twirling by his thumb.
It's like witnessing an slow but unavoidable train crash you can't stop."